Sample Preparation

How to ship bacterial culture for plasmid extraction?

The bacterial culture can be submitted in either 1 of following formats:

  1. stab agar or slant agar at room temperature; or
  2. cell pellet or glycerol stock with dry ice.

You must provide the information of the antibiotics for us to grow your targeted plasmid DNA in bacterial culture before plasmid extraction.
If you need plasmid DNA in the scale of maxiprep scale, you could provide us the purified plasmid directly. We can transform the plasmid DNA into E. coli competent cells and culture the plasmid in maxi scale before extraction.

Do you accept bacterial agar plate for genomic DNA extraction?

For Standard PCR Grade DNA extraction, we accept visible colonies on cut agar (5 mm x 5 mm) or cell pellet in microcentrifuge. You may refer to sample submission guidelines for more details -
https://base-asia.com/downloads/products/MBS/Sample-Submission-Guidelines-MBS-Services-v2.pdf

We do not recommend submitting agar plate because the plate is easily broken or damaged, and sample is eventually contaminated during transportation.

Do you provide Chloroplast DNA (cpDNA) extraction service for plant samples?

Specific organelle extraction like Chloroplast DNA (cpDNA) is typically required for Next-Generation Sequencing (NGS) to reduce the sequencing reads for each sample. We offer NGS Grade DNA extraction for cpDNA (NGS-1013). The process involved prior isolation of the target organelle from fresh green leaves, followed by DNA extraction.

Do you provide mitochondria DNA (mtDNA) extraction service for plant samples?

Specific organelle extraction like mitochondria DNA (mtDNA) is typically required for Next-Generation Sequencing (NGS) to reduce the sequencing reads for each sample. We offer NGS Grade DNA extraction for mtDNA (NGS-1020). The process involved prior isolation of the target organelle from animal tissue, followed by DNA extraction.

The size of mtDNA is typically small (e.g. 16kb), instead of extracting the mtDNA before sequencing, we could isolate mtDNA by amplifying the target region using 2 to 3 sets of long amplicons (e.g. 5kb to 8kb). With this, the reference sequence of the target mtDNA is required to design the PCR primers.

Do you provide DNA extraction service for any raw food or the processed food sample? For example: canned food, fruit jam, butter, milk, ham, fish cake and etc.

Q: Do you provide DNA extraction service for any raw food or the processed food sample? For example: canned food, fruit jam, butter, milk, ham, fish cake and etc.

Please email us at mbs@apicalscientific.com and let us know your downstream application for the extracted food DNA, we will then suggest the most suitable service for you.

Alternatively, we also offer PrimeWay® Food DNA Extraction Kits that has been optimized for a wide range of food including raw and processed food samples originating from animal, plant, mixed sources, or cultured bacteria. It is also suitable for food source authentication and GMO DNA isolation. You may refer to our website from the link below for more information.
https://base-asia.com/product/primeway-food-dna-extraction-kit/

Can you extract DNA from river water and then sequence them?

DNA extracted from environmental source also named as eDNA (abbreviation for environmental DNA). We offer eDNA extraction for water filter readily (NGS-1015). To ease the submission of samples, we recommend submitting the water filter. DNA extracted from water samples is usually not visible under typical agarose gel electrophoresis due to its nature, which is characterized by low DNA amount and degradation. Quality Control (QC) for a successful extracted DNA from water samples will associate with a pair of known PCR primers to confirm the absence of PCR inhibitors before the downstream experiment.

We also offer eDNA sequencing for water samples using 12s rRNA gene (NGS-7019). The fragment size of the target gene using MiFish-U1 primers generates small fragment size range from 170bp to 218bp. Amplifying this gene is tricky and if you are sending us your purified eDNA directly, we recommend you to confirm that the provided eDNA is free from PCR inhibitors by performing PCR QC before submitting the order.

1 Collins RA, Bakker J, Wangensteen OS, et al. Non‐specific amplification compromises environmental DNA metabarcoding with COI. Methods Ecol
Evol. 2019;10:1985-2001. https://doi.org/10.1111/2041-210X.13276

Do you provide DNA extraction services for stool sample?

Nucleic acid (either DNA or RNA) extracted from stool samples is typically associated with microbial studies. We offer DNA extraction for stool samples readily (NGS-1007). The optimized process will assure that it extracts all available DNA (e.g. both gram-positive and gram-negative bacteria, fungi and etc.) without any preference.

Alternatively, we also offer PrimeWay® Stool DNA Extraction Kit that has been optimised to handle a broad spectrum of stool types such as normal, dry, hard & high-fibre animal stool. You may refer to our website from the link below for more information.
https://base-asia.com/product/primeway-stool-dna-extraction-kit/

Do you provide DNA/ RNA extraction which is the purified nucleic acid that suitable for NGS application? What are the differences between Standard PCR Grade and NGS Grade DNA/ RNA extraction?

Q: Do you provide DNA/ RNA extraction which is the purified nucleic acid that suitable for NGS application? What are the differences between Standard PCR Grade and NGS Grade DNA/ RNA extraction?

The major difference between Standard PCR Grade and NGS Grade Nucleic Acid Extraction are their respective starting amount of the raw samples and Quality Control (QC) methods.

Standard PCR Grade DNA/ RNA extraction will only provide limited amount of nucleic acid that is sufficient for PCR applications. The QC of the extracted nucleic acid are only standard spectrophotometer reading and agarose gel electrophoresis assessment.

NGS Grade DNA/ RNA extraction will provide enough nucleic acid for NGS applications, where sometimes replicate of extraction will be performed to meet the required total amount of nucleic acid for each sample. The QC of the extracted nucleic acid includes spectrophotometer reading, fluorometric reading, agarose gel electrophoresis assessment, or/ and fragment integrity assessment by Bioanalyzer.

How to submit blood sample in EDTA tube for DNA extraction?

We recommend submitting blood sample in EDTA tube immediately after blood sample withdrawal. If sample could reach our laboratory within 3 days, you can ship sample in blue ice. Otherwise, you should ship the frozen blood with dry ice. For overseas customers, we recommend submitting blood sample in the format of buffy coat in 1.5 mL microcentrifuge tube using dry ice.

Please refer to the guidelines for sample submission on our website:
https://base-asia.com/wp-content/uploads/2024/07/Sample-Submission-Guidelines-for-Standard-Grade-Nucleic-Acid-Extraction_v4.pdf

What is the alternative if I unable get any courier company to ship blood samples using dry ice?

You may consider submitting saliva or buccal swab preserved in commercial collection kit. The sample will remain stable for years at room temperature and can be mailed using standard postal system.

Alternatively, we also offer PrimeWay® Genomic DNA II Extraction Kit that has been optimised to handle a broad spectrum of blood sample such as whole blood, buffy coat, nucleated blood and white blood cells. You may refer to our website from the link below for more information:

https://base-asia.com/product/primeway-genomic-ii-dna-extraction-kit/

What is the recommended way to submit animal tissue for DNA/ RNA extraction?

Nucleic acid, especially RNA degrades immediately right after the animal dies.

If you require higher grade of nucleic acid (e.g. NGS Grade), we recommend you preserve the animal tissue immediately during the sampling process. You can order commercially available preservation solutions (e.g. RNALater from Thermo Scientific) and follow their recommended protocols. To make sure the preservation solution penetrates deeply into the cut tissues, you will need to pay extra attention about the excised tissue size towards the ratio of the preservation solutions. Additional sampling surcharge is available if you need our help to excise the tissue from your raw samples directly. With this, you will be required to provide us with more information about the raw samples using Non-standard Raw Materials Submission Form.

Alternatively, we also offer PrimeWay® Genomic DNA II Extraction Kit that has been optimised to handle a broad spectrum of animal sample such as animal tissues, cultured cells and mouse tails. You may refer our website from the link below for more information:

https://base-asia.com/product/primeway-genomic-ii-dna-extraction-kit/

I do not have dry ice. Can I submit animal tissue for DNA barcoding services at room temperature?

You may store animal tissue (50 to 100 mg) in 5 times (5x) volume of absolute ethanol and ship at room temperature.

It is strongly recommended to keep them in screw-cap tube and label the tube ONLY with pencil or printed sticker. If there is a leakage of ethanol during transportation of your samples to our laboratory, any labelling using marker pen will not be recovered.

Can you remove contaminant like PCR inhibitors or excess RNA from my readily purified genomic DNA?

We offer additional purification services of Genomic DNA (MBS-6008). However, the additional purification will lose majority of the DNA and the process is irreversible.

 

For PCR applications, as the required amount of genomic DNA typically is low, additional purification saves most of the cases.

 

For NGS applications, there is a higher risk of losing the majority of the DNA, making the samples disqualified for processing due to insufficient DNA. We will recommend customer to optimize their extraction process from the raw samples directly to make sure the purity and quantity meets the sample requirements from the beginning instead of relying on the additional purification of Genomic DNA.

 

Alternatively, we also offer a series of column-based PrimeWay® Extraction Kits that has been optimised to remove the impurities during the nucleic acid extraction process. You may refer our website from the link below for more information.

https://base-asia.com/nucleic-acid-extraction/

What is the purity of maxiprep plasmid will be delivered?

The purified maxiprep plasmid is Ultrapure Transfection Grade. The purification was performed by using commercial kit. If you need endotoxin-free plasmid preparation service, please contact us to enquire.

Can you deliver linearized plasmid as final product?

We offer DNA digestion using Standard Restriction Enzyme (MBS-6002). Our Standard Restriction Enzyme (RE) includes BamHI, EcoRI, HindIII, NotI, SalI, XhoI and EcoRV. Additional surcharge will apply if you require other RE to be used with your samples. We will perform plasmid digestion using RE, followed by purification of the linearized plasmid.

I have a plasmid and wish to keep it as bacterial glycerol stock/stab culture. What service is recommended?

You may order: -

  1. Custom Bacterial Plasmid Miniprep Service (MBS-4001) and
  2. Plasmid Preparation Service: Stab Culture (MBS-4004), or Plasmid Preparation Service: Glycerol Stock (MBS-4005)

Do you have alternative service for bacterial glycerol stock as dry ice shipment charge is expensive?

You may order Plasmid Preparation Service: Stab Culture (MBS-4004) that ships at room temperature. For long term storage of plasmid DNA, customer is advised to prepare glycerol stock from the delivered stab culture within 2 weeks. The glycerol stock of plasmid DNA can be kept at -80oC for years.

I ordered bacterial glycerol stock. However, I receive it in the liquid condition, and they are not frozen. Can I still use it?

You should not use the glycerol stock. The cells usually die when the stock is left at room temperature for a while.

The bacterial glycerol stock of my subcloning culture does not work. I cannot obtain bacteria when I streak the bacteria on agar plate.

The bacteria might grow in low number or didn’t propagate well in culture media. We usually keep one replicate of glycerol stock for our subcloning products (excluding PCR product cloning) in freezer for one year after the project completes. We can make replacement for you if we still have them. Alternatively, you can inoculate the bacteria in broth and grow it overnight. Then, you can make new glycerol stock.

20) My freezer breaks down and the bacterial glycerol stock turns bad.

We recommend keeping both purified plasmid and glycerol stock in freezer. You still can transform the plasmid if the glycerol stock turns bad. Furthermore, always make new glycerol stock after a few freeze-thaw cycles (at least once a year), which depends on your frequency of usage.

I don’t have -80°C freezer. Can I store your provided bacterial glycerol stock at -20°C freezer?

We mix overnight bacterial culture with equal volume of 50% glycerol. The bacterial glycerol stock from -20°C freezer can be used but we do not guarantee its shelf-life.

How to store lyophilized plasmid, stab culture and glycerol stock?

Lyophilized plasmid is stable at -20°C for at least one year.

Stab culture stable at 4°C for two weeks.

Glycerol stock can be kept at -80°C for several years.

How should I amplify plasmid DNA from a stab culture or glycerol stock?

You may follow the steps below:

  1. Streak bacteria on agar plate with suitable antibiotic;
  2. isolate a single colony;
  3. inoculate it in LB containing suitable antibiotic; and
  4. perform plasmid extraction as usual.


 

 

 

 

PCR

I want to submit sample to amplify human gene and then perform Sanger Sequencing to detect single-nucleotide polymorphism (SNP) or other mutation. How should I proceed?

Q: I want to submit sample to amplify human gene and then perform Sanger Sequencing to detect single-nucleotide polymorphism (SNP) or other mutation. How should I proceed?

You may submit purified human genomic DNA for Optimization (MBS-2301) and subsequent screening services using both PCR and Sanger Sequencing (MBS- MBS-2331).

If you want us to extract the human genomic DNA from raw samples before the screening services using both PCR and Sanger Sequencing (MBS-2311), please refer to our sample submission guidelines:

  1. Purified human genomic DNA
    https://base-asia.com/downloads/products/MBS/Sample-Submission-Guidelines-MBS-Services-v2.pdf
  2. Raw Samples: Human Tissue/ Blood/ Saliva/ Buccal Swab
    https://base-asia.com/wp-content/uploads/2024/07/Sample-Submission-Guidelines-for-Standard-Grade-Nucleic-Acid-Extraction_v4.pdf

Do you provide SNP genotyping services?

Depends on sample size and the number of SNPs, we will recommend the most suitable approach to accommodate your experimental objectives. It can be combination of Targeted PCR, Sanger Sequencing, Next-Generation Sequencing, Third-Generation Sequencing or qPCR genotyping services.

 

I wish to amplify a specific gene from fungal samples. What preliminary check I should perform?

We recommend you perform Fungal DNA Barcoding in advance to verify the sample’s identity. This can boost your confidence in carrying out subsequent experiments.

We also offer Custom DNA Barcoding that uses the specific gene or primer sequences provided by customers (MBS-5007).

I expect mutation of short insertion and deletion (Indel) of my PCR products. The Sanger sequencing results typically shown noise signal or mixture of sequences right after the mutation point. Do you have any recommendation to obtain clean Sanger sequencing results from these samples?

Q: I expect mutation of short insertion and deletion (Indel) of my PCR products. The Sanger sequencing results typically shown noise signal or mixture of sequences right after the mutation point. Do you have any recommendation to obtain clean Sanger sequencing results from these samples?

You may freshly prepare unpurified PCR product and submit for PCR Product Cloning Service PLUS (MBS-3006). After cloning, up to 5 positive PCR colony will be submitted for bi-directional sequencing. The assembled sequence (up to 1.5kb) will be delivered to customer.

Among them, the mixture of different sequences had been separated by single colony. If you can’t find the expected Indel, you can screen more PCR colonies (MBS-3005) at separate charges.

Do you provide primer design for PCR service?

Our PCR optimization services include professional primer design by default.

Please provide us the target gene sequence, GenBank accession number and relevant research paper as reference.

I am not able to provide positive control for PCR service. Do you have any solution for this?

We recommend ordering gene synthesis and use the cloned DNA as positive control for PCR service. We could assist you in gene synthesis for PCR Service and you will need to elaborate this inquiry during the design of the Experimental Work Plan for your new PCR order.

 

 

 

 

Cloning and Synthetic Biology

The Sanger sequencing results witnessed my PCR product showed InDel mutation. Can you help me to perform PCR Product Cloning Service PLUS (MBS-3006) by using the remaining aliquot of PCR Product from sequencing?

Q: The Sanger sequencing results witnessed my PCR product showed InDel mutation. Can you help me to perform PCR Product Cloning Service PLUS (MBS-3006) by using the remaining aliquot of PCR Product from sequencing?

The remaining DNA amount after the Sanger sequencing services is typically insufficient for PCR Products Cloning Services and the risk of failure is high. We strongly recommend customer to prepare and submit fresh unpurified PCR product sample for PCR Product Cloning Service PLUS (MBS-3006).

I wish to clone 3 kb PCR product. What services you recommended?

You may order the Standard PCR Product Cloning service (MBS-3002), the sequencing of this standard service only deliver up to 1.5 kb of inserted fragment. You may order additional Primer Walking of Constructs Service - Single Pass (SS1008) to sequence the remaining inserted fragment (3kb – 1.5kb = 1.5kb); the total base of 1500 base will be charged under Primer Walking.

If my PCR product is a mixture, which service should I choose?

Depends on the complexity of your samples and advantages of each technology, we may refer you to several options as follows:

Option 1: Standard PCR Product Cloning and Sanger Sequencing (MBS-3006), which is PCR Product Cloning Service PLUS (up to 1.5 kb) that will pick up to 5 positive colony PCR products for sequencing verification.

Option 2: Direct Sequencing of PCR Products using Next-Generation Sequencing (NGS-9005). You may submit MiSeq overhang PCR products directly to join our regular amplicon sequencing using 300 PE reads. After adding the MiSeq overhang primers (+67bp), the final fragment size must between the range of 350bp to 650bp.

MiSeq Forward Overhang:

5’ TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG‐[locus specific primer sequence]

MiSeq Reverse Overhang:

5’ GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG‐[locus specific primer sequence]

We can assist you to assemble the sequencing PE reads at separate charges. We can also deliver the sequencing raw data directly for your own data analysis.

If the fragment size is < 350bp, we can sequence your PCR products in a separate flow cell using MiSeq 250 PE reads or MiSeq/ NovaSeq 150 PE reads. The cost of this option (custom sequencing run) will depend on number of PCR products to be sequenced in the same flow cell. Each PCR product will share the total output of the flow cell.

Option 3: Direct Sequencing of PCR Products using Third Generation Sequencing (NGS-7012). There is no limitation of fragment size to sequence long range PCR products using Third Generation Sequencing. We will perform the library preparation to add native barcodes onto the PCR products before sequencing.

We can assist you to assemble the sequencing PE reads at separate charges. We can also deliver the sequencing raw data directly for your own data analysis.

The cost of this option will depend on number of PCR products to be sequenced in the same flow cell.

What are the proviso charges if my PCR product is disqualified for PCR Cloning service?

We will perform quality check by using 2 µL of unpurified PCR product.

If the PCR product is absent or bad in quality, we will charge the quantification services for you to resend new samples.

Thus, it is important to access your sample quantity and quality using agarose gel electrophoresis before submitting the order.

Full charges will be applied when no positive clone obtained after picking of up to 8 clones.

After PCR Product Cloning, do you perform quality check by digesting plasmid using restriction enzyme?

We verify the inserted sequence by using only Sanger sequencing. Clean Sanger sequencing result could confirm the purity of plasmid is pure from single clone.  Anyhow, you can still order additional plasmid DNA verification by DNA digestion (MBS-6002).

My PCR product contains two close bands, should I order one or two PCR product cloning services?

When the difference between two DNA bands is less than 50 bp, we cannot guarantee successful excision of the individual bands from the gel. We recommend you order PCR Product cloning Service PLUS (MBS-3006). After colony PCR, up to 5 of the selected colony PCR products will be submitted for bi-directional sequencing. You may then order Custom Bacterial Plasmid Miniprep Service (MBS-4001) to get the individual plasmid DNA and their stab culture (MBS-4004) or glycerol stock (MBS-4005) respectively.

Can I sequence more colonies from your standard positive colony screening?

Our standard PCR Product Cloning Service (MBS-3002) will sequence only 1 positive clone; PCR Product Cloning Service PLUS (MBS-3006) will sequence up to 5 colony PCR products.

 

You may order another 24 clones to be screened (MBS-3005), followed by plasmid extraction (MBS-4001) for Sanger sequencing verification (SS1001) according to your choice of colonies.

 

We recommend such decision to be made within 2 weeks. The colonies on agar plate will degrade after 2 weeks at 4°C.

I want to perform in vitro transcription. What factors to be considered?

We provide pJET1.2™ from Thermo Scientific as the default holding vector for our PCR Product Cloning Services. It includes T7 RNA polymerase promoter for in vitro transcription of the cloned insert.

When you order the PCR Product Cloning Service, you may indicate the sense or antisense of transcripts.  The sense strand transcripts are used in expression, structural or functional studies. It can also be used to construct a standard curve for RNA quantification using an artificial sense strand of RNA. In contrast, the complementary antisense transcripts are required when they are used as a probe to messenger RNA (mRNA) in Northern blots, in situ hybridizations, and nuclease protection assays.

If you wish to incorporate T7 promoter in gene synthesis product before subcloning, we can help you in such design before you place the order. Please enquire when the Experimental Work Plan is being offered to your custom inquiry.

I have clones with various inserts at size > 5 kb, are you able to sequence them?

We recommend Direct Sequencing of Long-Range PCR Products using Third Generation Sequencing.

I want to order gene synthesis for subcloning. What other concerns should I pay attention?

There are two considerations:

  1. restriction enzymes for subcloning to be included in gene synthesis;
  2. the necessity of codon optimization according to your host.

Do you perform codon optimization before gene synthesis and subcloning?

By default, we will not perform codon optimization for gene synthesis.
If codon optimization for gene synthesis is required, customer must inform the host system before we design the Experimental Work Plan for your custom order.

After codon optimization is being developed, we will need to send back the optimized sequence to you for acceptance before processing the order.

I found some nucleotides change in the insert sequence after subcloning service is completed.

We strongly encourage customer to verify the original insert sequence from the holding vector before subcloning starts. If the change is verified to happen in the original insert sequence, you may order site-directed mutagenesis to correct the error.

Instead of sequence only the inserted fragment, you can now sequence the entire plasmid construct (including the inserted fragment) using Third Generation Sequencing readily (NGS-9006).

I wish to clone my PCR product into an expression vector. Can you do that?

We usually do not accept PCR products as starting material for subcloning because they are not stable. We would prefer the starting materials to be a plasmid DNA. Therefore, we recommend customer to clone PCR product into a standard holding vector (e.g. pJET1.2 or pGEM-T easy) and verify the inserted sequence using Sanger Sequencing before subcloning into expression vector.

If you do not have a PCR product, you can also chemically synthesis the gene sequences and order the subcloning into the choice of your expression vector. Please contact us to enquire.

Do you provide Site-Directed Mutagenesis (SDM) service?

We offer SDM under Custom Research Services (CRS). After SDM service, we strongly recommend customer to sequence the entire construct of plasmid DNA using Third Generation Sequencing readily (NGS-9006).

I have ordered PCR optimization and PCR product cloning. Why the insert gene sequence is not 100% identical to reference gene from NCBI database?

Q: I have ordered PCR optimization and PCR product cloning. Why the insert gene sequence is not 100% identical to reference gene from NCBI database?

The difference is due to the presence of single nucleotide polymorphisms (SNPs). They are common type of genetic variation among living organisms. If you require 100% identical of sequence as reference gene from NCBI database, you may order gene synthesis services directly.

What competent cells do you usually use for standard cloning and subcloning services?

We use DH10-beta E. coli competent cells in our PCR Product Cloning and Subcloning Services.

Can you transform plasmid into BL21 cells?

You may provide BL21 cells and its transformation protocol. We can perform transformation using Custom Bacterial Plasmid Miniprep Service (MBS-4001) and colony PCR screening to confirm the presence of plasmid DNA (MBS-3005).

Why plasmid extracted from BL21(DE3) E. coli cells shows inconsistent DNA patterns when digested by restriction enzymes?

The BL21(DE3) has endA and recA genes, hence the endonuclease 1 activity is present. The produced plasmid could be low yield or bad in quality. Thus, BL21(DE3) E. coli cells are recommended only for protein expression work.


 

 

 

 

DNA Barcoding

Is your DNA Barcoding Services ISO accredited?

Our service laboratory in Malaysia has demonstrated technical competence to operate in accordance with MS ISO/IEC 17025:2017 (ISO/IEC 17025:2017).
The Bacterial and Fungal DNA Barcoding Services are accredited by Jabatan Standard Malaysia (JSM) under SAMM 1084 for Nucleic Acid.

How to order and submit sample for DNA Barcoding?

For Malaysia and overseas customers, we only accept orders through our online ordering system: https://order.apicalscientific.com

For Singapore customers, please download the order form at https://base-asia.com/contact/sg/#orderforms and submit the order through email.

As for sample submission, you may refer to guidelines on our website:

https://base-asia.com/downloads/products/MBS/Sample-Submission-Guidelines-MBS-Services-v2.pdf

Can I submit glycerol stock for bacterial/fungal DNA barcoding Services?

Only 3 types of samples are acceptable:

  • Cut agar (5 mm x 5 mm) contained visible colonies; or
  • Cell pellet; or
  • Purified genomic DNA.

Do you provide DNA testing to determine bird’s gender?

We offer Avian DNA Sexing PCR Test (MBS-2502).

Do you provide DNA testing for bird’s diseases?

We offer the Avian DNA Disease Test Package (MBS-2501), which include:

  1. Avian Psittacine Beak and Feather Disease (PBFD) Test; and
  2. Avian Polyomavirus (APV) Test

Do you provide DNA Barcoding Services for Mixed Isolates of Microbial Samples or Environmental Samples?

We offer Metagenomic Sequencing (NGS-7000 series) using our Next-Generation Sequencing Service.

The standard DNA Barcoding Services did not have the target gene that I desire. Can I use my own primers for DNA Barcoding services?

We offer Custom DNA Barcoding Services (MBS-5007). The services include custom primers PCR optimization, PCR amplification, sequencing, and data analysis by NCBI BLAST.

What is Eukaryote DNA Barcoding Services?

Eukaryote DNA Barcoding is used to differentiate between prokaryote (e.g. bacteria) and eukaryote (e.g. fungi) by using 18S rRNA gene. It is commonly used to identify microalgae samples (green algae, seaweed, etc).

I have a green algae sample. Can I order Fungal DNA Barcoding Services that using ITS gene?

Our Fungal DNA Barcoding service is tested and verified on fungal sample only. We recommend you order Eukaryote DNA Barcoding Service (MBS-5006) for green algae.

For specific target gene and custom primer sequences, you may consider our Custom DNA Barcoding Service (MBS-5007) by providing us your primer sequences or reference paper.

I would like to submit a cyanobacteria sample for molecular identification. Which service is recommended?

You may order Bacterial DNA Barcoding (MBS-5002) using 16S rRNA gene for molecular identification.

Do you provide bootstrapping phylogenetic tree construction?

We can construct bootstrapping phylogenetic tree using MEGA software at separate charges. All reference sequences to be compared together with your samples must be provided in a single submission.

Can I request protocol used for genomic DNA extraction, PCR, primer sequence and sequencing of your DNA Barcoding Services?

We will provide the standard methodology in the final DNA Barcoding report.

Can I request PCR gel photo for DNA Barcoding Services?

Surcharge will be applied for this add-on request, please inform us in advance.

What is the level of accuracy for your DNA Barcoding Services?

We only guarantee the accuracy of the identification at genus level. If you are looking for accuracy of identification at species level, it is recommended to have a second reference of gene or additional biochemical or morphology test to re-confirm the results.

BLAST results did not show the expected species, is there a reason for this?

Although our DNA barcoding service can identify organism at genus level, it is not always the case when it comes to species level. We recommend identifying the unknown sample with universal DNA barcoding primers first. After which, more specific primers can be evaluated to further categorize the organisms at species level.

There is no BLAST result for my bacterial sample, can I resend sample for DNA barcoding again?

Newly submitted sample will be considered as new order.

What is Issue (1, 2, 3, 4 or 5) found in my report for my sample?

Please refer to “DNA Barcoding Report Guide.pdf” in the result folder.
We have prepared a result interpretation guide for DNA Barcoding Sequencing Result. This guide also provide explanation on the overall report format.

Please contact our Technical Support Team for any further enquiries.

There is Issue (1, 2, 3, 4 or 5) found in my report for my sample, can you recheck the sample again for verification?

You may request for further help from our technical support to troubleshoot your order.

Do you provide DNA Barcoding Services for cordyceps samples?

We offer Fungal DNA Barcoding Service (MBS-5004) for cordyceps samples.

If you wish to use your own primer sequences for molecular identification, you may consider our Custom DNA Barcoding Service (MBS-5007).

Do you provide DNA Barcoding Services for dried herb leaves?

We can perform modified DNA extraction prior Plant DNA Barcoding for dried herb leaves. Please contact us to enquire.