Universal Primers Offered

The following is the list of complimentary Universal Primers offered by our DNA Sequencing facility.

Universal Primers Sequence (5' - 3')
1492R  5' TACGGYTACCTTGTTACGACTT 3'
27F  5' AGAGTTTGATCMTGGCTCAG 3'
35S-A  5' AAGGGTCTTGCGAAGGATAG 3'
35S-B  5' AGTGGAAAAGGAAGGTGGCT 3'
518F  5' CCAGCAGCCGCGGTAATACG 3'
800R  5' TACCAGGGTATCTAATCC 3'
AD Reverse  5' AGATGGTGCACGATGCACAG 3'
a-Factor  5' TACTATTGCCAGCATTGCTGC 3'
AOX1 Forward  5' GACTGGTTCCAATTGACAAGC 3'
AOX1 Reverse  5' GCAAATGGCATTCTGACATCC  3'
BGH-R  5' TAGAAGGCACAGTCGAGG 3'
Bluescript KS 5' TCGAGGTCGACGGTATC 3'
Bluescript SK  5' CGCTCTAGAACTAGTGGATC 3'
CMV-F  5' CGCAAATGGGCGGTAGGCGTG 3'
CYC1 Reverse  5' GCGTGAATGTAAGCGTGAC 3'
DsRed1-C  5' AGCTGGACATCACCTCCCACAACG 3'
DsRed1-N 5' GTACTGGAACTGGGGGGACAG 3'
EBV-RP 5' GTGGTTTGTCCAAACTCATC 3'
EGFP-C 5' CATGGTCCTGCTGGAGTTCGTG 3'
EGFP-CF 5' AGCACCCAGTCCGCCCTGAGC 3'
EGFP-CR  5' CGTCCATGCCGAGAGTG 3'
EGFP-N 5' CGTCGCCGTCCAGCTCGACCAG 3'
EGFP-NR 5' CGTCGCCGTCCAGCTC 3'
GAL1 Forward  5' AATATACCTCTATACTTTAACGTC 3'
Gal4AD 5' TACCACTACAATGGATG 3'
GLprimer1 5' TGTATCTTATGGTACTGTAACTG 3'
GLprimer2 5' CTTTATGTTTTTGGCGTCTTCCA 3'
HCO2198 5' TAAACTTCAGGGTGACCAAAAAATCA 3'
ITS1 5' TCCGTAGGTGAACCTGCGG 3'
ITS2   5' GCTGCGTTCTTCATCGATGC 3'
ITS3 5' GCATCGATGAAGAACGCAGC 3'
ITS4 5' TCCTCCGCTTATTGATATGC 3'
ITS5 5' GGAAGTAAAAGTCGTAACAAGG 3'
KAN2-FP   5' ACCTACAACAAAGCTCTCATCAACC 3'
KAN2-RP 5' GCAATGTAACATCAGAGATTTTGAG 3' 
LCO1490 5' GGTCAACAAATCATAAAGATATTGG 3'
LpJET1.2F  5' CTGCTTTAACACTTGTGCCTGA 3'
LpJET1.2R 5' TTCCTGATGAGGTGGTTAGCAT 3'
M13F (-20)  5' GTAAAACGACGGCCAGT 3'
M13F (-29) 5' CACGACGTTGTAAAACGAC 3'
M13-FP 5' TGTAAAACGACGGCCAGT 3' 
M13F-pUC(-40) 5' GTTTTCCCAGTCACGAC 3'
M13R (-20) 5' GCGGATAACAATTTCACACAGG 3'
M13R (-24) 5' GGAAACAGCTATGACCATG 3'
M13R-pUC (-26)  5' CAGGAAACAGCTATGAC 3'
MT Forward 5' CATCTCAGTGCAACTAAA 3'
pBacPAC-RP 5' GTCTGTAAATCAACAACGC 3'
pBAD-F 5' ATGCCATAGCATTTTTATCCA 3'
pBAD-FP 5' ATGCCATAGCATTTTTATCC 3'
pBAD-R  5' GATTTAATCTGTATCAGG 3'
pBRrevBam 5' GGTGATGTCGGCGATATAGG 3'
pDONOR-FP 5' TAACGCTAGCATGGATCTC 3'
pEGFP_N  5' CCGTCCAGCTCGACCAG 3'
pEGFP-FP 5' TTTAGTGAACCGTCAGATC 3'
pEGFP-RP 5' AACAGCTCCTCGCCCTTG 3'
pESP-RP 5' TCCAAAAGAAGTCGAGTGG 3'
pET-24a 5' GGGTTATGCTAGTTATTGCTCAG 3'
pET-RP 5' CTAGTTATTGCTCAGCGG 3'
pFastBac Forward 5' GGATTATTCATACCGTCCCA 3'
pFastBac Reverse 5' CAAATGTGGTATGGCTGATT 3'
pGEX3 5' GGAGCTGCATGTGTCAGAGG 3'
pGEX5 5' GGCAAGCCACGTTTGGTG 3'
pJET1.2F 5' CGACTCACTATAGGGAGAGCGGC 3'
pJET1.2R 5' AAGAACATCGATTTTCCATGGCAG 3'
pMalE 5' TCAGACTGTCGATGAAGC 3'
pQE-F 5' CCCGAAAAGTGCCACCTG 3'
pQE-R 5' GTTCTGAGGTCATTACTGG 3'
pREP-fwd 5' GCTCGATACAATAAACGCC 3'
pRH Forward 5' CTGTCTCTATACTCCCCTATAG 3'
pRH Reverse 5' CAAAATTCAATAGTTACTATCGC 3'
pTrcHis Forward 5' GAGGTATATATTAATGTATCG 3'
QE Promoter 5' CCGAAAAGTGCCACCTG 3'
RVprimer3 5' CTAGCAAAATAGGCTGTCCC 3'
RVprimer4 5' GACGATAGTCATGCCCCGCG 3'
SP6 5' ATTTAGGTGACACTATAG 3'
STag 18mer Primer 5' GAACGCCAGCACATGGAC 3'
SV40-pArev 5' CCTCTACAAATGTGGTATGG 3'
SV40-Promoter 5' GCCCCTAACTCCGCCCATCC 3'
T3 5' ATTAACCCTCACTAAAG 3'
T7 5' AATACGACTCACTATAG 3'
T7 EEV 5' ATGTCGTAATAACCCCGCCCCG 3'
T7promoter 5' TAATACGACTCACTATAGGG 3'
T7terminator 5' GCTAGTTATTGCTCAGCGG 3'
U-19mer Primer 5' GTTTTCCCAGTCACGACGT 3'
SP6Long 5'-ATTTAGGTGACACTATAGAATAC-3' 
T7Long 5'-GTAATACGACTCACTATAGGGC-3'
LpJet1_2F 5' CTGCTTTAACACTTGTGCCTGA 3'
LpJet1_2R 5' TTCCTGATGAGGTGGTTAGCAT 3'
785F 5' GGATTAGATACCCTGGTA 3'
907R 5' CCGTCAATTCMTTTRAGTTT 3'