//base-asia.com/wp-content/uploads/2021/11/seqplus.jpg
//base-asia.com/wp-content/uploads/2021/09/seqplusimage.jpg

Save the hassle of preparing purified DNA for sequencing and leave your unpurified samples to us. We will do the purification and deliver the best quality results to you.

Whatever sample type you have, we can work with it!

For Unpurified PCR Product

1st BASE Sequencing+ PLUS service allows you to submit PCR products directly off the cycler, saving you the hassle and cost of PCR purification. This service is only recommended for unpurified PCR products that shown single band on agarose gel.

We will perform the PCR clean-up before sequence the purified PCR products directly. Our PCR purification recovery rate is up to 90%. Thus, it is important for you to check the presence of the PCR products before submitting for Sequencing+ PLUS. If additional agarose gel quantification is required before or/ and after the PCR clean-up, a nominal fee will be applied.

For Plasmid

We also accept bacteria culture* for Sequencing+ PLUS service. Send in the cultured broth samples and cell pellet for a fuss free and prompt service, with clean reads >1000bp. Samples which require culturing at our facilities are acceptable as well but might be subjected to a slightly longer turnaround time.

For samples that require culturing at our facilities, we recommend you submit your order latest by Wednesday evening of each week.

*Only vector host by E Coli with Amp/Kanamycin resistance are accepted at our facilities for bacteria culture submission.

*** Applicable for Singapore Customers only.

Online Ordering

1st BASE Online Ordering, 1oo (strongly recommended)

1st BASE Order Online simple as 1-2-3.
Try it now! It is amazingly easy to use and hassle-free!
To find out more about how to use 1oo, please click here.


Email Ordering

Download and complete the 1st BASE DNA Sequencing Order Form (under Downloads tab) with your order requirements.
Email the form to our email address below:

Singapore
Email: sequencing@axilscientific.com
Tel: +65 6775 7318

Malaysia / International
Email: sequencing@apicalscientific.com
Tel: +603 8943 3252

For customers who ship or courier us the orders directly, please indicate your airway bill number or courier tracking number in your Online Order or email to ensure speedy processing of your orders.

Confidentiality

All sequences and reports will be kept confidential. Non-disclosure agreement is available upon request.


Click below for Guides on Preparations and Requirements

Singapore Malaysia International
Order Forms*

*Please enable the Macro function in Microsoft Office Excel.

The following is the list of complimentary Universal Primers offered by our DNA Sequencing facility.

Universal Primers Sequence (5' - 3')
1492R  5' TACGGYTACCTTGTTACGACTT 3'
27F  5' AGAGTTTGATCMTGGCTCAG 3'
35S-A  5' AAGGGTCTTGCGAAGGATAG 3'
35S-B  5' AGTGGAAAAGGAAGGTGGCT 3'
518F  5' CCAGCAGCCGCGGTAATACG 3'
800R  5' TACCAGGGTATCTAATCC 3'
AD Reverse  5' AGATGGTGCACGATGCACAG 3'
a-Factor  5' TACTATTGCCAGCATTGCTGC 3'
AOX1 Forward  5' GACTGGTTCCAATTGACAAGC 3'
AOX1 Reverse  5' GCAAATGGCATTCTGACATCC  3'
BGH-R  5' TAGAAGGCACAGTCGAGG 3'
Bluescript KS 5' TCGAGGTCGACGGTATC 3'
Bluescript SK  5' CGCTCTAGAACTAGTGGATC 3'
CMV-F  5' CGCAAATGGGCGGTAGGCGTG 3'
CMV-profor  5' ATGGGCGGTAGGCGTG 3'
CYC1 Reverse  5' GCGTGAATGTAAGCGTGAC 3'
DsRed1-C  5' AGCTGGACATCACCTCCCACAACG 3'
DsRed1-N 5' GTACTGGAACTGGGGGGACAG 3'
EBV-RP 5' GTGGTTTGTCCAAACTCATC 3'
EGFP-C 5' CATGGTCCTGCTGGAGTTCGTG 3'
EGFP-CF 5' AGCACCCAGTCCGCCCTGAGC 3'
EGFP-CR  5' CGTCCATGCCGAGAGTG 3'
EGFP-N 5' CGTCGCCGTCCAGCTCGACCAG 3'
EGFP-NR 5' CGTCGCCGTCCAGCTC 3'
GAL1 Forward  5' AATATACCTCTATACTTTAACGTC 3'
Gal4AD 5' TACCACTACAATGGATG 3'
GLprimer1 5' TGTATCTTATGGTACTGTAACTG 3'
GLprimer2 5' CTTTATGTTTTTGGCGTCTTCCA 3'
HCO2198 5' TAAACTTCAGGGTGACCAAAAAATCA 3'
hU6-F Primer 5’-GAGGGCCTATTTCCCATGATT-3’
ITS1 5' TCCGTAGGTGAACCTGCGG 3'
ITS2   5' GCTGCGTTCTTCATCGATGC 3'
ITS3 5' GCATCGATGAAGAACGCAGC 3'
ITS4 5' TCCTCCGCTTATTGATATGC 3'
ITS5 5' GGAAGTAAAAGTCGTAACAAGG 3'
KAN2-FP   5' ACCTACAACAAAGCTCTCATCAACC 3'
KAN2-RP 5' GCAATGTAACATCAGAGATTTTGAG 3'
LCO1490 5' GGTCAACAAATCATAAAGATATTGG 3'
LpJET1.2F  5' CTGCTTTAACACTTGTGCCTGA 3'
LpJET1.2R 5' TTCCTGATGAGGTGGTTAGCAT 3'
M13F (-20)  5' GTAAAACGACGGCCAGT 3'
M13F (-29) 5' CACGACGTTGTAAAACGAC 3'
M13-FP 5' TGTAAAACGACGGCCAGT 3'
M13F-pUC(-40) 5' GTTTTCCCAGTCACGAC 3'
M13R (-20) 5' GCGGATAACAATTTCACACAGG 3'
M13R (-24) 5' GGAAACAGCTATGACCATG 3'
M13R-pUC (-26)  5' CAGGAAACAGCTATGAC 3'
MT Forward 5' CATCTCAGTGCAACTAAA 3'
pBacPAC-RP 5' GTCTGTAAATCAACAACGC 3'
pBAD-F 5' ATGCCATAGCATTTTTATCCA 3'
pBAD-FP 5' ATGCCATAGCATTTTTATCC 3'
pBAD-R  5' GATTTAATCTGTATCAGG 3'
pBRrevBam 5' GGTGATGTCGGCGATATAGG 3'
pDONOR-FP 5' TAACGCTAGCATGGATCTC 3'
pEGFP_N  5' CCGTCCAGCTCGACCAG 3'
pEGFP-FP 5' TTTAGTGAACCGTCAGATC 3'
pEGFP-RP 5' AACAGCTCCTCGCCCTTG 3'
pESP-RP 5' TCCAAAAGAAGTCGAGTGG 3'
pET-24a 5' GGGTTATGCTAGTTATTGCTCAG 3'
pET-RP 5' CTAGTTATTGCTCAGCGG 3'
pFastBac Forward 5' GGATTATTCATACCGTCCCA 3'
pFastBac Reverse 5' CAAATGTGGTATGGCTGATT 3'
pGEX3 5' GGAGCTGCATGTGTCAGAGG 3'
pGEX5 5' GGCAAGCCACGTTTGGTG 3'
pJET1.2F 5' CGACTCACTATAGGGAGAGCGGC 3'
pJET1.2R 5' AAGAACATCGATTTTCCATGGCAG 3'
pMalE 5' TCAGACTGTCGATGAAGC 3'
pQE-F 5' CCCGAAAAGTGCCACCTG 3'
pQE-R 5' GTTCTGAGGTCATTACTGG 3'
pREP-fwd 5' GCTCGATACAATAAACGCC 3'
pRH Forward 5' CTGTCTCTATACTCCCCTATAG 3'
pRH Reverse 5' CAAAATTCAATAGTTACTATCGC 3'
pTrcHis Forward 5' GAGGTATATATTAATGTATCG 3'
QE Promoter 5' CCGAAAAGTGCCACCTG 3'
RVprimer3 5' CTAGCAAAATAGGCTGTCCC 3'
RVprimer4 5' GACGATAGTCATGCCCCGCG 3'
SP6 5' ATTTAGGTGACACTATAG 3'
STag 18mer Primer 5' GAACGCCAGCACATGGAC 3'
SV40-pArev 5' CCTCTACAAATGTGGTATGG 3'
SV40-Promoter 5' GCCCCTAACTCCGCCCATCC 3'
T3 5' ATTAACCCTCACTAAAG 3'
T7 5' AATACGACTCACTATAG 3'
T7 EEV 5' ATGTCGTAATAACCCCGCCCCG 3'
T7promoter 5' TAATACGACTCACTATAGGG 3'
T7terminator 5' GCTAGTTATTGCTCAGCGG 3'
U-19mer Primer 5' GTTTTCCCAGTCACGACGT 3'
U6 Primer 5’-GGGCAGGAAGAGGGCCTAT-3’
SP6Long 5'-ATTTAGGTGACACTATAGAATAC-3'
T7Long 5'-GTAATACGACTCACTATAGGGC-3'
LpJet1_2F 5' CTGCTTTAACACTTGTGCCTGA 3'
LpJet1_2R 5' TTCCTGATGAGGTGGTTAGCAT 3'
785F 5' GGATTAGATACCCTGGTA 3'
907R 5' CCGTCAATTCMTTTRAGTTT 3'