We provide single directional and bi-directional primer walking of DNA constructs.

Bi-directional Primer Walk

For bi-directional primer walking, DNA sequencing will start with two universal primers and is continued using primers derived from the ends of the newly determined DNA sequences until the whole insert/ fragment is fully sequenced until both ends. This provides 2x reads for the inserted DNA. If there are any ambiguities in the sequence, we will design new primers to resolve them.

Figure 1: Bi-directional primer walking of construct provides 99.9% accuracy with a double confirmation of the insert sequence on both strands.

Single Pass Primer Walk

For single pass primer walking, DNA sequencing will start with two universal primers and is continued using primers derived from the ends of the newly determined DNA sequences until the overlapping region of both strands are determined. This provides 1x read for the inserted DNA.

Figure 2: Single pass primer walking of constructs provides a faster turnaround rate with 98.5% accuracy of the insert sequence.

Primer Walking Service Includes:

  • Primer design & synthesis
  • DNA sequencing reactions using the designed primer(s)
  • Data assembly and sequence aligning to generate the consensus sequence

Specifications

The service is charged as per length for the cloned DNA. This service is only recommended for insert sizes less than 7 kb. If you have an inserted DNA > 7 kb, we may process your order as a custom project under our Molecular Biology Services (link to MBS-8001).

During the 1st round of sequencing reactions using the Universal Primers of the holding vector successful, we will send the results to customer to confirm its presence of the inserted DNA. Once customer gives the greenlight to proceed the order, then only we will start the primer walking. We will provide weekly update until the end of the primer walking.

Shall the first round of sequencing reactions failed to meet customer’s expectation, we will terminate the order and only charge for the sequencing reactions.

The base pair charges start from the first until the last base of the inserted fragment in the holding vector. Customer is required to provide vector name and RE cut sites (if this applies) for data alignment.

Online Ordering

1st BASE Online Ordering, 1oo (strongly recommended)

1st BASE Order Online simple as 1-2-3.
Try it now! It is amazingly easy to use and hassle-free!
To find out more about how to use 1oo, please click here.


Email Ordering

Download and complete the 1st BASE DNA Sequencing Order Form (under Downloads tab) with your order requirements.
Email the form to our email address below:

Singapore
Email: sequencing@axilscientific.com
Tel: +65 6775 7318

Malaysia / International
Email: sequencing@apicalscientific.com
Tel: +603 8943 3252

For customers who ship or courier us the orders directly, please indicate your airway bill number or courier tracking number in your Online Order or email to ensure speedy processing of your orders.

Confidentiality

All sequences and reports will be kept confidential. Non-disclosure agreement is available upon request.


Click below for Guides on Preparations and Requirements

Singapore Malaysia International
Order Forms*

*Please enable the Macro function in Microsoft Office Excel.

The following is the list of complimentary Universal Primers offered by our DNA Sequencing facility.

Universal Primers Sequence (5' - 3')
1492R  5' TACGGYTACCTTGTTACGACTT 3'
27F  5' AGAGTTTGATCMTGGCTCAG 3'
35S-A  5' AAGGGTCTTGCGAAGGATAG 3'
35S-B  5' AGTGGAAAAGGAAGGTGGCT 3'
518F  5' CCAGCAGCCGCGGTAATACG 3'
800R  5' TACCAGGGTATCTAATCC 3'
AD Reverse  5' AGATGGTGCACGATGCACAG 3'
a-Factor  5' TACTATTGCCAGCATTGCTGC 3'
AOX1 Forward  5' GACTGGTTCCAATTGACAAGC 3'
AOX1 Reverse  5' GCAAATGGCATTCTGACATCC  3'
BGH-R  5' TAGAAGGCACAGTCGAGG 3'
Bluescript KS 5' TCGAGGTCGACGGTATC 3'
Bluescript SK  5' CGCTCTAGAACTAGTGGATC 3'
CMV-F  5' CGCAAATGGGCGGTAGGCGTG 3'
CMV-profor  5' ATGGGCGGTAGGCGTG 3'
CYC1 Reverse  5' GCGTGAATGTAAGCGTGAC 3'
DsRed1-C  5' AGCTGGACATCACCTCCCACAACG 3'
DsRed1-N 5' GTACTGGAACTGGGGGGACAG 3'
EBV-RP 5' GTGGTTTGTCCAAACTCATC 3'
EGFP-C 5' CATGGTCCTGCTGGAGTTCGTG 3'
EGFP-CF 5' AGCACCCAGTCCGCCCTGAGC 3'
EGFP-CR  5' CGTCCATGCCGAGAGTG 3'
EGFP-N 5' CGTCGCCGTCCAGCTCGACCAG 3'
EGFP-NR 5' CGTCGCCGTCCAGCTC 3'
GAL1 Forward  5' AATATACCTCTATACTTTAACGTC 3'
Gal4AD 5' TACCACTACAATGGATG 3'
GLprimer1 5' TGTATCTTATGGTACTGTAACTG 3'
GLprimer2 5' CTTTATGTTTTTGGCGTCTTCCA 3'
HCO2198 5' TAAACTTCAGGGTGACCAAAAAATCA 3'
hU6-F Primer 5’-GAGGGCCTATTTCCCATGATT-3’
ITS1 5' TCCGTAGGTGAACCTGCGG 3'
ITS2   5' GCTGCGTTCTTCATCGATGC 3'
ITS3 5' GCATCGATGAAGAACGCAGC 3'
ITS4 5' TCCTCCGCTTATTGATATGC 3'
ITS5 5' GGAAGTAAAAGTCGTAACAAGG 3'
KAN2-FP   5' ACCTACAACAAAGCTCTCATCAACC 3'
KAN2-RP 5' GCAATGTAACATCAGAGATTTTGAG 3'
LCO1490 5' GGTCAACAAATCATAAAGATATTGG 3'
LpJET1.2F  5' CTGCTTTAACACTTGTGCCTGA 3'
LpJET1.2R 5' TTCCTGATGAGGTGGTTAGCAT 3'
M13F (-20)  5' GTAAAACGACGGCCAGT 3'
M13F (-29) 5' CACGACGTTGTAAAACGAC 3'
M13-FP 5' TGTAAAACGACGGCCAGT 3'
M13F-pUC(-40) 5' GTTTTCCCAGTCACGAC 3'
M13R (-20) 5' GCGGATAACAATTTCACACAGG 3'
M13R (-24) 5' GGAAACAGCTATGACCATG 3'
M13R-pUC (-26)  5' CAGGAAACAGCTATGAC 3'
MT Forward 5' CATCTCAGTGCAACTAAA 3'
pBacPAC-RP 5' GTCTGTAAATCAACAACGC 3'
pBAD-F 5' ATGCCATAGCATTTTTATCCA 3'
pBAD-FP 5' ATGCCATAGCATTTTTATCC 3'
pBAD-R  5' GATTTAATCTGTATCAGG 3'
pBRrevBam 5' GGTGATGTCGGCGATATAGG 3'
pDONOR-FP 5' TAACGCTAGCATGGATCTC 3'
pEGFP_N  5' CCGTCCAGCTCGACCAG 3'
pEGFP-FP 5' TTTAGTGAACCGTCAGATC 3'
pEGFP-RP 5' AACAGCTCCTCGCCCTTG 3'
pESP-RP 5' TCCAAAAGAAGTCGAGTGG 3'
pET-24a 5' GGGTTATGCTAGTTATTGCTCAG 3'
pET-RP 5' CTAGTTATTGCTCAGCGG 3'
pFastBac Forward 5' GGATTATTCATACCGTCCCA 3'
pFastBac Reverse 5' CAAATGTGGTATGGCTGATT 3'
pGEX3 5' GGAGCTGCATGTGTCAGAGG 3'
pGEX5 5' GGCAAGCCACGTTTGGTG 3'
pJET1.2F 5' CGACTCACTATAGGGAGAGCGGC 3'
pJET1.2R 5' AAGAACATCGATTTTCCATGGCAG 3'
pMalE 5' TCAGACTGTCGATGAAGC 3'
pQE-F 5' CCCGAAAAGTGCCACCTG 3'
pQE-R 5' GTTCTGAGGTCATTACTGG 3'
pREP-fwd 5' GCTCGATACAATAAACGCC 3'
pRH Forward 5' CTGTCTCTATACTCCCCTATAG 3'
pRH Reverse 5' CAAAATTCAATAGTTACTATCGC 3'
pTrcHis Forward 5' GAGGTATATATTAATGTATCG 3'
QE Promoter 5' CCGAAAAGTGCCACCTG 3'
RVprimer3 5' CTAGCAAAATAGGCTGTCCC 3'
RVprimer4 5' GACGATAGTCATGCCCCGCG 3'
SP6 5' ATTTAGGTGACACTATAG 3'
STag 18mer Primer 5' GAACGCCAGCACATGGAC 3'
SV40-pArev 5' CCTCTACAAATGTGGTATGG 3'
SV40-Promoter 5' GCCCCTAACTCCGCCCATCC 3'
T3 5' ATTAACCCTCACTAAAG 3'
T7 5' AATACGACTCACTATAG 3'
T7 EEV 5' ATGTCGTAATAACCCCGCCCCG 3'
T7promoter 5' TAATACGACTCACTATAGGG 3'
T7terminator 5' GCTAGTTATTGCTCAGCGG 3'
U-19mer Primer 5' GTTTTCCCAGTCACGACGT 3'
U6 Primer 5’-GGGCAGGAAGAGGGCCTAT-3’
SP6Long 5'-ATTTAGGTGACACTATAGAATAC-3'
T7Long 5'-GTAATACGACTCACTATAGGGC-3'
LpJet1_2F 5' CTGCTTTAACACTTGTGCCTGA 3'
LpJet1_2R 5' TTCCTGATGAGGTGGTTAGCAT 3'
785F 5' GGATTAGATACCCTGGTA 3'
907R 5' CCGTCAATTCMTTTRAGTTT 3'