Shotgun Sequencing Assembly

In shotgun sequencing, DNA is broken up randomly into numerous small segments, which are sequenced using the chain termination method to obtain reads. Multiple overlapping reads for the target DNA are obtained by performing several rounds of this fragmentation and sequencing. Sequence assembly softwares then use the overlapping ends of different reads to assemble them into a continuous sequence.

For example, consider the following two rounds of shotgun reads:

Strand

 

Sequence

 

Original

CATGCTGCAGTCATGCTTAGGCTA

First shotgun sequence

CATGCTGCAGTCATGCT------- 
-----------------TAGGCTA

 

Second shotgun sequence

CATGCT------------------ 
------CTGCAGTCATGCTTAGGCTA

 

Reconstruction

CATGCTGCAGTCATGCTTAGGCTA

Please contact us for project consultation and price enquiry.

Specification:

Product Number

Description

MBS-8003 NEW

Shotgun Sequencing Assembly , price per project